99
|
SYSTAT
sigmaplot v Sigmaplot V, supplied by SYSTAT, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/SigmaPlot+v14%2E0/pm25750082-81-10-14 Average 99 stars, based on 1 article reviews
sigmaplot v - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
96
|
Molecular Devices LLC
pro software Pro Software, supplied by Molecular Devices LLC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/SoftMax+Pro+Software/pmc04951047-184-7-9 Average 96 stars, based on 1 article reviews
pro software - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
90
|
STEMCELL Technologies Inc
stemdiff™ cerebral organoid kit Stemdiff™ Cerebral Organoid Kit, supplied by STEMCELL Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/stemdiff+cerebral+organoid+kit/pm39009885-304-166-171 Average 90 stars, based on 1 article reviews
stemdiff™ cerebral organoid kit - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
86
|
Obio Technology Corp Ltd
aav camkiia mcherry obio technology cat Aav Camkiia Mcherry Obio Technology Cat, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/Virus+strains+AAV+CaMKIIa+EGFP+Obio+Technology+Cat+AOV012/pm36516774-191-34-35 Average 86 stars, based on 1 article reviews
aav camkiia mcherry obio technology cat - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Kissei Pharmaceutical
algorithms vital recorder kissei comtec rrid scr 018199 Algorithms Vital Recorder Kissei Comtec Rrid Scr 018199, supplied by Kissei Pharmaceutical, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/vitalrecorder/pm36516774-191-124-127 Average 86 stars, based on 1 article reviews
algorithms vital recorder kissei comtec rrid scr 018199 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Kissei Pharmaceutical
vitalrecorder2 sleepsign 3 0 kissei comtec rrid scr 018200 Vitalrecorder2 Sleepsign 3 0 Kissei Comtec Rrid Scr 018200, supplied by Kissei Pharmaceutical, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/0+018200+2+3+biosignal+comtec+kissei+rrid+scr+sleepsign+vitalrecorder2/pm36516774-191-133-136 Average 86 stars, based on 1 article reviews
vitalrecorder2 sleepsign 3 0 kissei comtec rrid scr 018200 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Tokyo Chemical Industry
2 3 5 trimethyl 3 thiazoline tmt tci cat t1068 2 3 5 Trimethyl 3 Thiazoline Tmt Tci Cat T1068, supplied by Tokyo Chemical Industry, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/4+chemical+chemicals+from+india+industry+ol+procured+tci+terpinen+tokyo/pm36516774-191-94-96 Average 86 stars, based on 1 article reviews
2 3 5 trimethyl 3 thiazoline tmt tci cat t1068 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
94
|
OriGene
gaatgccaccttcatccgagaag reverse Gaatgccaccttcatccgagaag Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/Ptgs1+Mouse+qPCR+Primer+Pair/pm42234557-282-119-122 Average 94 stars, based on 1 article reviews
gaatgccaccttcatccgagaag reverse - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
86
|
Nanoprobes Inc
goldenhancetm em plus nanoprobes Goldenhancetm Em Plus Nanoprobes, supplied by Nanoprobes Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/em+goldenhance+kit/pm42234557-282-59-62 Average 86 stars, based on 1 article reviews
goldenhancetm em plus nanoprobes - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
94
|
OriGene
tcgcctccaactcaagctggtt reverse Tcgcctccaactcaagctggtt Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/Ptgds+Mouse+qPCR+Primer+Pair/pm42234557-282-97-100 Average 94 stars, based on 1 article reviews
tcgcctccaactcaagctggtt reverse - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
94
|
OriGene
gcgacatactcaagcaggagca reverse Gcgacatactcaagcaggagca Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/Ptgs2+Mouse+qPCR+Primer+Pair/pm42234557-282-130-133 Average 94 stars, based on 1 article reviews
gcgacatactcaagcaggagca reverse - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
94
|
OriGene
gtcttgagtccagatttgcagcc origene mp211819 primers for cox1 Gtcttgagtccagatttgcagcc Origene Mp211819 Primers For Cox1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/enzyme+kinetics+module+of+sigmaplot+12%2E5/Ptges+Mouse+qPCR+Primer+Pair/pm42234557-282-110-111 Average 94 stars, based on 1 article reviews
gtcttgagtccagatttgcagcc origene mp211819 primers for cox1 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |